snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans W08G11.6
sequence
ATGCACCTTGCACTCTACGCCTTTCCTTTCAATGGGTTGGTATGATTTAATAAGGATGC
AAGAGAATAGTACGGGAAGTTCGAAGACTTGCGGATTTGCTTCCACGGCTCCGCGAGTTC
ATAACTGTCACCACAATT
  Box motif
  Complementary to target RNA
length 137
organism Caenorhabditis_elegans
snoRNA name W08G11.6
alias CeN41
chromosome ⁄ contig V
locus ⁄ host gene W08G11.3
organization Intronic
target RNA 26S rRNA, 18S rRNA
modification type H/ACA
modification site 18S:U513,26S:U2977
accession no AM051027,NR_002679
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved