snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C14C10.8
sequence
AAAGCAGTCGTTCAGTGGCGCAAGCGATTTTCCCATGCGCTTGTGCCTAATCTTTGACT
GCGAGATAAAAATGTCAGAGTCAAGCGGTCCGCTATCTGTGTAGCATTCTGTTCAAGATT
TGACTGATATTT
  Box motif
  Complementary to target RNA
length 131
organism Caenorhabditis_elegans
snoRNA name C14C10.8
alias CeN126
chromosome ⁄ contig V
locus ⁄ host gene ril-2
organization Intronic
target RNA 26S rRNA
modification type H/ACA
modification site 26S:U3220,26S:U2828,26S:U1270
accession no AM051049,NR_003466
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved