snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans W04D2.7
sequence
GCTTCTGTGATCGACAACAAACCCAGCTCTCTGAATGATTGTGAGGTTAAGAAAACAGC
TGAGAAGC
  Box motif
  Complementary to target RNA
length 67
organism Caenorhabditis_elegans
snoRNA name W04D2.7
alias
chromosome ⁄ contig V
locus ⁄ host gene inx-11
organization Intronic
target RNA 26S rRNA
modification type C/D
modification site 26S:C3060
accession no AM051017,NR_002677
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved