snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C51F7.3
sequence
GATCTATGATGAGACTTTCACGACGGTCTTCCGATGTAATACATACCTGTGGATATCTT
TACGTGAAGCTGAGATC
  Box motif
  Complementary to target RNA
length 76
organism Caenorhabditis_elegans
snoRNA name C51F7.3
alias CeN123
chromosome ⁄ contig V
locus ⁄ host gene frm-7
organization Intronic
target RNA 26S rRNA
modification type C/D
modification site 26S:C3071
accession no AM051018,NR_001522
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved