snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F55A11.10
sequence
GAGCGGTGATGAATGCACGTATTGCTCTGACACCTCTTATGTTAGCGGTAAATTTCCGT
GCCGCGATGAGTCCACTAGGATCTCTGAGCTC
  Box motif
  Complementary to target RNA
length 91
organism Caenorhabditis_elegans
snoRNA name F55A11.10
alias CeN124
chromosome ⁄ contig V
locus ⁄ host gene F55A11.6
organization Intronic
target RNA 26S rRNA
modification type C/D
modification site 26S:G2903
accession no AM051015,NR_001523
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved