snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F17C11.14
sequence
TGTCGAAGAGTAGTCATTTGTATACGTGATACACTTATACAGAGTTACACTTTTCGTAT
ATAAGTGCTTCTTCTCGTTGGAGTTGTTTATTTAATGAGCAATTACCTCTAAACTGAAAG
CAACAATT
  Box motif
  Complementary to target RNA
length 127
organism Caenorhabditis_elegans
snoRNA name F17C11.14
alias CeN81
chromosome ⁄ contig V
locus ⁄ host gene F17C11.9
organization Intronic
target RNA 26S rRNA
modification type H/ACA
modification site 26S:U2361
accession no AM051042,NR_003473
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved