snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans D1054.17
sequence
ACAGGATGATGAGTCACTCGCTGAGTGACAATAAGCCGAGTGTTAGCGGTTTTTATGTA
ATCGTGATGATCATTCCCTCAAAAGCGATAATTGTGAACTGACTGTC
  Box motif
  Complementary to target RNA
length 106
organism Caenorhabditis_elegans
snoRNA name D1054.17
alias CeN69
chromosome ⁄ contig V
locus ⁄ host gene D1054.3
organization Intronic
target RNA U2 snRNA
modification type C/D
modification site U2:G12
accession no AM051020,NR_002672
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved