snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans K07C5.12
sequence
GTAACCTCTCTTATAAGCCGGGGGACTAGCATTTTGTTAAGTTCACTAGTAAAATGAGA
GGTAAAGCATAGAGACAACCAGACACCGAGAATGTTTTGATGTTTTCGGTCACTTTGTGT
GTCCCACAAAT
  Box motif
  Complementary to target RNA
length 130
organism Caenorhabditis_elegans
snoRNA name K07C5.12
alias CeN101
chromosome ⁄ contig V
locus ⁄ host gene K07C5.4
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1266
accession no AM051033,NR_003478
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved