snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans K07C5.10
sequence
ATGGCATGTATTTAATGCGGGTGGATGATTTTAGTTCAGCCGTTTAGCTTGCATGCAAA
ATTATTTTCTATTGAAGATTTTATTCGCTGCACTCGGTCATATTCGAGTCTATGATTTTT
CTGAAATTGGTACATTT
  Box motif
  Complementary to target RNA
length 136
organism Caenorhabditis_elegans
snoRNA name K07C5.10
alias
chromosome ⁄ contig V
locus ⁄ host gene K07C5.4
organization Intronic
target RNA 26S rRNA
modification type H/ACA
modification site 26S:U1058
accession no AM051036,NR_002675
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved