snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C27H6.5
sequence
TGGGCGGTGAAATTGTTGCACAGACCTGTTCCTATTAGTTCACTGAGGAAAATAGCAAT
CATGAGCCT
  Box motif
  Complementary to target RNA
length 68
organism Caenorhabditis_elegans
snoRNA name C27H6.5
alias Ce67,CeN136
chromosome ⁄ contig V
locus ⁄ host gene unc-41
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site
accession no DQ789531,NR_003468
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved