snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans ZK994.7
sequence
GCGCAATGAATGTTTAACCATCTTTCGGCTGAATCCATGATGCCAATTTTCAAAATACT
GAGCGCAT
  Box motif
  Complementary to target RNA
length 67
organism Caenorhabditis_elegans
snoRNA name ZK994.7
alias
chromosome ⁄ contig V
locus ⁄ host gene pxn-1
organization Intronic
target RNA 26S rRNA
modification type C/D
modification site 26S:A862
accession no NR_003485
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved