snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C16D9.11
sequence
AACTACCCAATAGTGTTAGGCGTACACTAGAAGGCCCGTGAAGACACGAATTACCGTCT
GATAACTAATGACGCTACCATGGCTGTAAACCAGAGGCCGA
  Box motif
  Complementary to target RNA
length 100
organism Caenorhabditis_elegans
snoRNA name C16D9.11
alias Ce86, CeN35
chromosome ⁄ contig V
locus ⁄ host gene rol-3
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site
accession no AY948628,NR_003467
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved