snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans K11C4.6
sequence
CCTCGATGACGATTCACCTAGCTCACTCAGACATACAACTGGTGATAAAAAAATTTCGT
GTCTTAGAGAC
  Box motif
  Complementary to target RNA
length 70
organism Caenorhabditis_elegans
snoRNA name K11C4.6
alias
chromosome ⁄ contig V
locus ⁄ host gene unc-70
organization Intronic
target RNA 26S rRNA
modification type C/D
modification site
accession no NR_003479
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved