snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y116A8C.50
sequence
TCAAGTGCTGTGAAGAGAACGTGCCACTGTACTTTGCCCATCGGAAGGGCATTGAAATG
GAGATATACCTGGCACAGGGGCCATCTGAGCACTT
  Box motif
  Complementary to target RNA
length 94
organism Caenorhabditis_elegans
snoRNA name Y116A8C.50
alias CeN98
chromosome ⁄ contig IV
locus ⁄ host gene uaf-2
organization Intronic
target RNA U6 snRNA
modification type C/D
modification site U6:C55
accession no AM051023,NR_003456
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved