snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans JC8.15
sequence
CGCACCTTGTTTTCACGCATTCTCGGTCAGTTTTCTCGAGATTCAACGCGTCCAGAAAG
TGTGCTATATAGAAATAAAGAGTACTTTATAAGGGCCATACACGGTTTAATTTACCCCGG
CTATGGTAGTTTAACGGTGCTACAAAT
  Box motif
  Complementary to target RNA
length 146
organism Caenorhabditis_elegans
snoRNA name JC8.15
alias
chromosome ⁄ contig IV
locus ⁄ host gene tag-115
organization Intronic
target RNA U4 snRNA
modification type H/ACA
modification site U4:U62
accession no AM051052,NR_023966
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved