snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F28D1.13
sequence
TACGAGGTCCAGAGTCACCTCTGAGAATATGTATCTCTTCGGTGCTAGGATTGCTCGAA
AATGAATTAGGTACTTTATGCAAACAGTTCTTGCGTTATGCTCATCTGTTTCACCTCCGT
TTCTGACAAAA
  Box motif
  Complementary to target RNA
length 130
organism Caenorhabditis_elegans
snoRNA name F28D1.13
alias
chromosome ⁄ contig IV
locus ⁄ host gene rps-23
organization Intronic
target RNA 26S rRNA
modification type H/ACA
modification site 26S:U2519,26S:U2558
accession no AM051044,NR_003449
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved