snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C10C6.8
sequence
TTATGGCGGATAGGAACCAGGTCATGTTTGTACGTGATTTGGGCCGACATCCCCGCCGA
AATAGTCCTGCGAAGATCTAAGGTCGCTTCTGGATGGATTTGCCACCGGGTGCACACCAT
CTTCGTGCACAATT
  Box motif
  Complementary to target RNA
length 133
organism Caenorhabditis_elegans
snoRNA name C10C6.8
alias CeN39
chromosome ⁄ contig IV
locus ⁄ host gene C10C6.6
organization Intronic
target RNA 26S rRNA
modification type H/ACA
modification site 26S:U2992
accession no AM051048,NR_003441
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved