snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F38E11.14
sequence
GGTCGATGATTAGATTATTCTACTGTTCACGTACCGACTGTTCAGTGGTGGATAAACCT
TCTATGAGACTT
  Box motif
  Complementary to target RNA
length 71
organism Caenorhabditis_elegans
snoRNA name F38E11.14
alias
chromosome ⁄ contig IV
locus ⁄ host gene cng-3
organization Intronic
target RNA 26S rRNA
modification type C/D
modification site 26S:U1566
accession no AM050844,NR_003451
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved