snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans D1046.6
sequence
CCCGCGCCTAGAAACTCAGCGGTGTTTTGTCTTTATGATCATGAGCTGGTAGCAGGTGC
AATATTGATTCGGAGTCTTACCGGCGTCCACCTTCTGAAGGGTGTGCGTTAAAAGTTCAT
CCGAACAATT
  Box motif
  Complementary to target RNA
length 129
organism Caenorhabditis_elegans
snoRNA name D1046.6
alias CeN55
chromosome ⁄ contig IV
locus ⁄ host gene D1046.1
organization Intronic
target RNA 26S rRNA
modification type H/ACA
modification site 26S:U1176
accession no AM051037,NR_003446
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved