snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans K11H12.12
sequence
TTGCCTCAGTGTCTGGGCAAAGCAGACTGTTTTTAATAGTACTGACTTAATCCACTGAT
GGCTATAGAAAAACATTGTGTAATCCCCGAACACCTTGTGGTGTATTGGATTCATGACAT
TGTGACAATT
  Box motif
  Complementary to target RNA
length 129
organism Caenorhabditis_elegans
snoRNA name K11H12.12
alias CeN84
chromosome ⁄ contig IV
locus ⁄ host gene rpl-15
organization Intronic
target RNA 26S rRNA
modification type H/ACA
modification site 26S:U2294,26S:U2417
accession no AM051040,NR_003452
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved