snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans K08E3.11
sequence
GTAGTGATGAAAATCATGCTAATCATGAAGAGGCGCGTCCGTCTCGGACCCCATGTTGC
AAACATCTATTTCTGAAC
  Box motif
  Complementary to target RNA
length 77
organism Caenorhabditis_elegans
snoRNA name K08E3.11
alias
chromosome ⁄ contig III
locus ⁄ host gene cyk-4
organization Intronic
target RNA 26S rRNA
modification type C/D
modification site
accession no NR_003432
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved