snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C50C3.14
sequence
GGTATAAGAAAGCGAGCAATTATTCGATGGCTGCTCGTTGATAATTCCTCGAAAACTAA
TGGAAATTAAGCGATTATCCGCCTCATGAACAGATCCATCATTTAACTTGAATGATAAGG
TCTACTTGACAGGCGTACATTA
  Box motif
  Complementary to target RNA
length 141
organism Caenorhabditis_elegans
snoRNA name C50C3.14
alias
chromosome ⁄ contig III
locus ⁄ host gene prp-8
organization Intronic
target RNA U2 snRNA
modification type H/ACA
modification site U2:U41
accession no AM051051,NR_023959
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved