snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C50C3.13
sequence
GCGGATATTATAAACAGATTCCTATAAATTTACAAGGTAGTCAGTAGCCGAAATTCGCA
ATATAAATTTTCCATTAAAGGCGAGAAATCATCCTTTTTGTCGGTGATATCTAGAAATAA
AACTGGAGACAATT
  Box motif
  Complementary to target RNA
length 133
organism Caenorhabditis_elegans
snoRNA name C50C3.13
alias
chromosome ⁄ contig III
locus ⁄ host gene prp-8
organization Intronic
target RNA U2 snRNA, U5 snRNA
modification type H/ACA
modification site U2:U16,U5:U36
accession no AM051050,NR_023958
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved