snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C07H6.10
sequence
GCGCGATGAGGATTGATAACACATACACACACTCTGAAGTTATGTGAAGAGATAATTGA
AGAACGGATATCTGAGCGC
  Box motif
  Complementary to target RNA
length 78
organism Caenorhabditis_elegans
snoRNA name C07H6.10
alias CeN89
chromosome ⁄ contig III
locus ⁄ host gene cgh-1
organization Intronic
target RNA U2 snRNA
modification type C/D
modification site U2:C42
accession no AM051021,NR_003427
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved