snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans R151.12
sequence
ATACAGCATCGAAAATGGACGGACTTTCCCGATGGATCGTTTCGTATAATTTTGGTGCA
AAATAGTAGAGAGACGCAGTGTTACTCTTCCTTACGTTACCTGTATCTGGAGAGTGTCAA
GCGTTTCCCACA
  Box motif
  Complementary to target RNA
length 131
organism Caenorhabditis_elegans
snoRNA name R151.12
alias CeN80
chromosome ⁄ contig III
locus ⁄ host gene rpl-6
organization Intronic
target RNA
modification type H/ACA
modification site 18S:U1523,18S:U1156
accession no AM051034,NR_003433
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved