snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C16A3.11
sequence
ACGCTCTTCAAAAGCACTGGTTATCGGACTCAGACTTGTCCATGCCAGCCGTCAAAATG
AGCAATATGAAATATCCTGTTTTTGGGTGAGGTGTAACTGTATTTAGATTAGATCTCAAT
AACACGATGACAGTT
  Box motif
  Complementary to target RNA
length 134
organism Caenorhabditis_elegans
snoRNA name C16A3.11
alias
chromosome ⁄ contig III
locus ⁄ host gene rps-13
organization Intronic
target RNA
modification type H/ACA
modification site 26S:U2966,26S:U3035
accession no AY948705,NR_002636
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved