snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans B0393.10
sequence
GATTGTCGTGAATCTTGATCGGCGTGTTTATTTTACCCGCGTTGATTGTAAAGGCCGAC
ATATATCAAAATTTGACATTAATGCTGGAAGTTTCTGAAATAGTTCCATTTTTCTTCCAA
TTATTTCAAATGTCAAACAAAC
  Box motif
  Complementary to target RNA
length 141
organism Caenorhabditis_elegans
snoRNA name B0393.10
alias CeN105
chromosome ⁄ contig III
locus ⁄ host gene B0393.3
organization Intronic
target RNA U5 snRNA
modification type H/ACA
modification site U5:U48
accession no AM051054,NR_023957
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved