snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans B0412.6
sequence
AATGCAGATGTCCATTACGAAAAGGCTCTTTACCTTTTGACGTTTAGTTAAATTTGCGA
AATAAAATTGATGTCTCGAAGACATGTGCTTCATATTTTGATGCTCATGTTCAAGATCAG
CAAACAAAC
  Box motif
  Complementary to target RNA
length 128
organism Caenorhabditis_elegans
snoRNA name B0412.6
alias cer-6
chromosome ⁄ contig III
locus ⁄ host gene rps-29
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1254
accession no AB125755,NR_002634
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved