snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F19H8.6
sequence
GTGCGATGAAGGTTAATGATAAGTTTCGGCTGACTCAAATTGATGACACCTTTAATATG
CTGAGCACT
  Box motif
  Complementary to target RNA
length 68
organism Caenorhabditis_elegans
snoRNA name F19H8.6
alias
chromosome ⁄ contig II
locus ⁄ host gene F19H8.4
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site
accession no NR_023950
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved