snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F01D5.12
sequence
CACGTCTGGTGAGGATGAAAACAGGACAGGTTTCGCTAAAATATTACCGAATGCCAATA
TGTCGAGACACCTTGGCTGTCTGAGGACG
  Box motif
  Complementary to target RNA
length 88
organism Caenorhabditis_elegans
snoRNA name F01D5.12
alias CeN28
chromosome ⁄ contig II
locus ⁄ host gene F01D5.10
organization Intronic
target RNA 26S rRNA
modification type C/D
modification site
accession no AY948623,NR_003406
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved