snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans K12D12.8
sequence
TGTCTAAAGGCGCGGCGCAACATTTTTAAACTTTCCGATGATTTGTGATTACTAAAAGG
CGAATCTGAGGCG
  Box motif
  Complementary to target RNA
length 72
organism Caenorhabditis_elegans
snoRNA name K12D12.8
alias
chromosome ⁄ contig II
locus ⁄ host gene top-2
organization Intronic
target RNA U5 snRNA
modification type C/D
modification site
accession no NR_003414
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved