snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans K12D12.7
sequence
GTTTTTCTAGAGATTTCACCGATTCTTTTGAAGTATCGGTGCACCAAGTGAAAAATAAA
ATTGCGACGCTTTAGTGACGCTGGAGAAAGTTTTTATCCAGTGTCTAAAGGCGCGGCGCA
ACATTT
  Box motif
  Complementary to target RNA
length 125
organism Caenorhabditis_elegans
snoRNA name K12D12.7
alias CeN128
chromosome ⁄ contig II
locus ⁄ host gene top-2
organization Intronic
target RNA U5 snRNA
modification type H/ACA
modification site U5:U45
accession no AM051053,NR_003413
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved