snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y62F5A.11
sequence
CCCAAAATGACGAAACCCTATCCCCAATGATTTTACGACGTTTCAAGTCATTTCCATAT
CAATCGGCGACCTACTACACCGTCTTTTGATTGACCTGAAACGCGTAGAGCTAGTGAATC
TTCATCATAACGATAAGATCTGATTGG
  Box motif
  Complementary to target RNA
length 146
organism Caenorhabditis_elegans
snoRNA name Y62F5A.11
alias
chromosome ⁄ contig II
locus ⁄ host gene mdt-8
organization Intronic
target RNA U2 snRNA
modification type C/D
modification site U2:U49
accession no AM051022,NR_023955
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved