snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans T06D8.11
sequence
AAGCCGATGATTACCAAAAATAACCAAATGTTTGAGTGATTGTTTGTGATCGAATTTTG
TCACTATCGCTGAGGCTT
  Box motif
  Complementary to target RNA
length 77
organism Caenorhabditis_elegans
snoRNA name T06D8.11
alias CeN120
chromosome ⁄ contig II
locus ⁄ host gene T06D8.3
organization Intronic
target RNA 26S rRNA
modification type C/D
modification site 26S:A3159
accession no AM051019,NR_001493
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved