snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans M106.6
sequence
TGTCAATGATGTCTAAAAAATTACTACGATTTAATTCGAATTGCTGTGAGATCAATCTT
ATACAATTCTGAGACA
  Box motif
  Complementary to target RNA
length 75
organism Caenorhabditis_elegans
snoRNA name M106.6
alias CeN119
chromosome ⁄ contig II
locus ⁄ host gene mix-1
organization Intronic
target RNA 26S rRNA
modification type C/D
modification site 26S:A2317
accession no AM050846,NR_001492
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved