snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F28C6.11
sequence
TGTTTCCATTAAGTAGTCCCGTACGTTGAAATTTTCACGTACGGTTTGGACAATATGGA
GAAATGAATGTTACTCTTTTTGCAATGACGCTGAAACATATTTTCGCTTTGTTAGCCATA
AGTTTAAAACAATT
  Box motif
  Complementary to target RNA
length 133
organism Caenorhabditis_elegans
snoRNA name F28C6.11
alias CeN93
chromosome ⁄ contig II
locus ⁄ host gene rpl-26
organization Intronic
target RNA 26S rRNA
modification type H/ACA
modification site 26S:U2483
accession no AM051043,NR_003407
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved