snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F54C9.12
sequence
GAAAAAGTGCGATGAATGACTTGGATAAGTTTCGGCTGAAACTTGGTGATGCCAACTTT
TTAAAACTGCTGAGCACTTTTTC
  Box motif
  Complementary to target RNA
length 82
organism Caenorhabditis_elegans
snoRNA name F54C9.12
alias CeN108
chromosome ⁄ contig II
locus ⁄ host gene iff-2
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A422
accession no NR_003409
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved