snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans T24H7.6
sequence
CTGCGTCTCTCCAACCCGGACAACTCGCAACTTGTTGCAATGGTCAGTTCGACTGTTAG
AGACGCTAAATAAGAAAATTGGCGGATTCGCTAACGTCGCGTCCCATGACCGGAGTTTGA
AAGTAGGCCGCTGAACAATT
  Box motif
  Complementary to target RNA
length 139
organism Caenorhabditis_elegans
snoRNA name T24H7.6
alias CeN58
chromosome ⁄ contig II
locus ⁄ host gene T24H7.2
organization Intronic
target RNA 26S rRNA
modification type H/ACA
modification site 26S:U1573,26S:U2040,26S:U2454
accession no AM051038,NR_003417
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved