snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans ZK546.18
sequence
ATGCACACAGAAAGTCGAGATTGCCGGCTTCAAAGGCTTTATCGTTGATTACGTGTGCT
ATAACAACGCCATAGGTATCATTCTTCGTCTTCTTAGGCGCGGAACATCTAAATATGGCT
ACATTT
  Box motif
  Complementary to target RNA
length 125
organism Caenorhabditis_elegans
snoRNA name ZK546.18
alias CeN48
chromosome ⁄ contig II
locus ⁄ host gene mdt-4
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U971
accession no AM051029,NR_003422
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved