snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F22D6.16
sequence
CCCCGCTCTATGTTCCTCTCCACTTTGTTAATTTTCTGGAATGGAGATTTTATAAGAGC
GAAAATAAAATGTCATTAGCGGTGCTCATCTTCGGTTAATTTTCTCGATATGGCTGATTG
GATAATGACTACATTT
  Box motif
  Complementary to target RNA
length 135
organism Caenorhabditis_elegans
snoRNA name F22D6.16
alias
chromosome ⁄ contig I
locus ⁄ host gene prpf-4
organization Intronic
target RNA U6 snRNA
modification type H/ACA
modification site U6:U26
accession no AM051055,NR_003380
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved