snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans T08B2.13
sequence
TGCCCGGTCTTTGCCCCGGATCAACTTTAATAGTTATGACGGTTTCCGACTCGGGAAAA
TAGATTCTTGCATAACGACGGAAATTTCAGAGTTTGTTCTGAATGTCTCCAGTCGATGTG
CAATACAATT
  Box motif
  Complementary to target RNA
length 129
organism Caenorhabditis_elegans
snoRNA name T08B2.13
alias CeN43
chromosome ⁄ contig I
locus ⁄ host gene frs-1
organization Intronic
target RNA 26S rRNA
modification type H/ACA
modification site 26S:U1996
accession no AM051039,NR_003387
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved