snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans B0041.9
sequence
GACATAATTAGATTCGGTTATTGATTATTTTAATTTCAAACTAACTTCTGTGTT
  Box motif
  Complementary to target RNA
length 54
organism Caenorhabditis_elegans
snoRNA name B0041.9
alias
chromosome ⁄ contig I
locus ⁄ host gene rpl-4
organization Intronic
target RNA 26S rRNA
modification type C/D
modification site
accession no DQ789561,NR_003378
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved