snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans R12E2.17
sequence
GTTTGTGATGACTGCATACGGATCACTGGGCTCTGAATCTCTATGAACCGATAATATCC
GTTCTGATA
  Box motif
  Complementary to target RNA
length 68
organism Caenorhabditis_elegans
snoRNA name R12E2.17
alias CeN54
chromosome ⁄ contig I
locus ⁄ host gene rpn-8
organization Intronic
target RNA 26S rRNA
modification type C/D
modification site 26S:C2300
accession no AM050845,NR_003385
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved