snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans E01A2.9
sequence
TGTGTCATTTATTCCTCGGATAGTGATATTTGTTCCTTTTCGAGCTCATACTGACACAA
AAGCAATGGCAGATTTGCAACTAGTTGCGTTCTACTTGATCGTGGCTATACTTTCTTCTG
ACCACATT
  Box motif
  Complementary to target RNA
length 127
organism Caenorhabditis_elegans
snoRNA name E01A2.9
alias
chromosome ⁄ contig I
locus ⁄ host gene E01A2.6
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U499, 18S:U1082
accession no AM051025,NR_023941
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved