snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y71F9AM.7
sequence
CACGGCCAGTTTGAGTTGATTCGCTCTTTCGCAATAGAGCTTTGAGTCAAATTACTGTC
CGGAAATTATAGAGATGAAGCTCATTTGGAGCAATAACAATTGTTGAAGCTCCGAAAATG
ATGCTCTTCCCACAATT
  Box motif
  Complementary to target RNA
length 136
organism Caenorhabditis_elegans
snoRNA name Y71F9AM.7
alias CeN59
chromosome ⁄ contig I
locus ⁄ host gene cogc-3
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1152
accession no AM051031,NR_003395
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved