snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y37E3.21
sequence
CGCTCCTATCTTGGCGCTTCCATTGGTGAATATGGCTGTGTATGTTATAGGAGAGATAG
TAGTGCCTTTTGGCTTTCGGATCTCCTTCGGTGTTTGTCTTGCATCTCGACAAATGTCAT
CCTCTGGGTTCGAGACAATT
  Box motif
  Complementary to target RNA
length 139
organism Caenorhabditis_elegans
snoRNA name Y37E3.21
alias CeN95
chromosome ⁄ contig I
locus ⁄ host gene Y37E3.8
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no AY948717,NR_003392
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved