snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F53G12.12
sequence
ATGCTCTTCAAAAGCACTGGTTTTAGGATCCACTATTATCCAAGCCAGCCGTCAAAACT
GAGCTATAAGAATTATCTTGTTTTTGGGTGAGGTGTATTCAATTCAGAATGCGTCTCAAT
AACACGATGACAATT
  Box motif
  Complementary to target RNA
length 134
organism Caenorhabditis_elegans
snoRNA name F53G12.12
alias CeN87
chromosome ⁄ contig I
locus ⁄ host gene rpl-7
organization Intronic
target RNA 26S rRNA
modification type H/ACA
modification site 26S:U2966,26S:U3035
accession no AM051047,NR_002606
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved