snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans C07A9.14
sequence
GGTTGGCTGTGACGATTACTATTCCCAACGCTTGGAATGAACCAAAGTGATTATTAACC
AATCCTTTTCTGAGCCAATC
  Box motif
  Complementary to target RNA
length 79
organism Caenorhabditis_elegans
snoRNA name C07A9.14
alias CeN30
chromosome ⁄ contig III
locus ⁄ host gene Mono:27:C07A9.14
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:A3023
accession no AM051016,NR_003426
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved