snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F56C9.12
sequence
TCACCAATGATGCAATGGTTAAATCAGACGAGTCTATTTTGGCTATCTATTCGAGTTCT
TCGAAGAAATTGCCGCTAAGCGGGGTGAAATTGAGGCATTTGTCTGAGGTGA
  Box motif
  Complementary to target RNA
length 111
organism Caenorhabditis_elegans
snoRNA name F56C9.12
alias CeN17
chromosome ⁄ contig III
locus ⁄ host gene Mono:25:F56C9.12
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:A2384
accession no AM050850,NR_002643
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved