snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y53F4B.47
sequence
CCGCATATGAAGACCACTAAATGACGAATCCTAATAACCCAATGGGTTTCATTGCGGAT
ATGAGGCATTTGTCTGAGCGG
  Box motif
  Complementary to target RNA
length 80
organism Caenorhabditis_elegans
snoRNA name Y53F4B.47
alias CeN23-1
chromosome ⁄ contig II
locus ⁄ host gene Mono:20:Y53F4B.47
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:A2384
accession no AM050848,NR_003420
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved